Pediatric Molecular Neuro-Oncology Lab - Tumor Resistance to Therapy

Background:

Primary brain tumors occur in 18,000 Americans each year. In children, brain tumors are second only to leukemia in incidence and account for the majority of all pediatric cancer deaths.

Advances in radiotherapy and chemotherapy, complementing more extensive surgical resections, have significantly increased survival for some malignant pediatric brain tumors.

However, RT and CT are of limited benefit for many pediatric brain tumors because of histology (e.g. malignant gliomas), anatomic location (e.g. brain stem gliomas) and age (infant malignant brain tumors). The limited efficacy of RT and CT reflects the inability to overcome limitations imposed by the basic biology of pediatric brain tumors and surrounding normal brain. Improving CT in infants and young patients with brain tumors is of particular importance given the long-term effects of RT on physical and mental development. In the very young CT takes a predominant role in brain tumor therapy with RT being reserved for recurrent tumors. Increased effectiveness of RT and CT, with surgical advances, can be expected to improve survival for pediatric brain tumors.

DNA repair has been implicated as a critical determinant of tumor susceptibility to DNA damaging based therapies. Of interest to our lab are variation in DNA repair and cellular response to therapy, developing molecular techniques to alter repair and access the change in cellular resistance and changes in repair activity in response to therapy.

Research Question:

I. What are the major molecular mechanisms of Pediatric brain tumor resistance to Therapy?

II. How can therapies be altered to effectively treat Children with brain tumors?

Research Highlights:

Dr. Bobola’s laboratory presently has a few projects ongoing:

I. Measuring DNA repair activities in pediatric brain tumors and elucidating relationships with tumor malignancy and resistance to Therapy.

II. Using a variety of biochemical and genetic engineering techniques to specifically alter DNA repair in pediatric-brain-tumor-derived cell lines to directly evaluate the mechanism of cellular resistance to therapy.

III. Develop techniques to alter specific molecular pathways in vitro and in vivo to elevate tumor sensitivity to therapy

IV. Evaluate the molecular/cellular response to therapeutic agents.

With the data being collected we hope to develop models that can:

1. Predict patient out come given certain tumor variables, both molecular and morphological, and predict the best therapeutic protocol specific to the patient;
2. Determine in advance how a tumor may evolve in response to therapy and develop protocols that will prevent resistant recurrent tumors;
3. Determine the predominant molecular/cellular factors involved in tumor resistance to therapy:
4. Design more effective therapies.
   

Within tumor heterogeneity in AAG APE and pol b activities. Immunohistochemistry using: row 1, polyclonal anti-human APE antibody and row 2, polyclonal anti-rat pol b antibody against a GBM column A and a medulloblastoma column B. 6-C is a control for non-specific binding using pre-immune serum.

Anti-sense suppression Techniques are being developed to suppress APE and pol b activities in human-brain-tumor-derived cell lines with anti-sense oligonucleotides.

We have successfully suppressed APE activity, in the adult-glioblastoma-cell line SNB 19. The cationic lipid, Lipofectin, is being used to facilitate uptake of oligonucleotides into cell lines. The controls for these experiments include the use of lipid alone, lipid and sense oligonucleotide, and no lipid/no oligonucleotide. We are presently developing techniques to improve suppression, to suppress activity in additional cell lines, and directly evaluate the effect on cellular sensitivity. We have developed two antisense oligonucleotides to suppress APE activity and three to suppress pol b. The antisense sequences are given below and a more detailed description is given in the appendix.
APE
TCCCACGCTTCGGCAT- Overlaps the protein start site
TTCCCTTACCTGTCCTGA – Overlaps an intron/exon splice site
Pol b
GGCGCCTTCCGTTTGCTCAT - Overlaps the protein start site
GGTGATTCCCCCGTTGAGAGT- 3’end of mRNA about 50 nucleotides into coding sequence
GGGTTCCCGGTATTTCCACT - 5’ end of mRNA
Controls for these constructs are the sense orientation and mis-sense oligos.

SNB 19 cells were treated with 250 nM oligo and 25 ug/ml Lipofectin on Day one in DMEM/F12 with no supplements (including no antibiotic/antimycotic). On Day 3, media was replaced with fresh oligo/lipid in DMEM/F12. On Day 5 cell were harvested, extracted and assayed for APE activity. Controls, mis-sense and no treatment, displayed an activity of 0.21 and 0.24 fmoles AP sites nicked/ cell min respectively; while, anti-sense treated cell had only 0.065 fmoles AP sites nicked/ cell min. APE activity is derived from the slope of the lines displayed in the graph, specifically the slope is in units of ug abasic sites nicked/cell 15 min.

The oligos used in this experiment are as follows:
Anti-sense:
AS-3 5’ TCCCACGCTTCGGCAT 3’ - Overlaps the protein start site
As-4 5’ TTCCCTTACCTGTCCTGA 3’ – Overlaps an intron/exon splice site
The controls were mis-sense constructs, which are basically the same sequence in the reverse order, i.e. 3’ and 5’ orientations are switched.
Suppression of APE activity is accompanied by decreased alkylating agent resistance. Exposure of SNB19 to ASO increased sensitivity to the methylator methylmethane sulfonate (MMS) and to the clinical chloroethylating agent 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU). Treatment with AS3 + AS4 reduced MMS resistance relative to mis-sense-treated cells by two mechanisms (Fig. 3, left). First, a shoulder of resistance was eliminated, indicating that APE was responsible for the insensitivity of SNB19 to low MMS doses. Second, the slope of the linear portion of the survival curve was increased, indicating a greater rate of killing. Overall, the dose required to produce 10% survival (LD10) was reduced 1.6-fold from 380 µM to 240 µM. Importantly, the increased killing was specific to ASO; as shown, the sensitivity of mis-sense-treated cells was the same as that of cells treated with lipofectin or medium alone. ASO treatment also increased the rate of BCNU killing 1.5-fold, reducing LD10 from 21 µM to 14 µM (Fig. 2, right). BCNU sensitivity was identical for cells treated with mis-sense oligonucleotide, lipofectin alone or medium alone, indicating that decreased resistance was specifically due to the ASO. These observations provide preliminary evidence that APE contributes to glioma resistance to alkylating agents.

Sub-confluent SNB19 grown in serum supplemented DMEM/F12 were washed twice with pre-warmed PBS and then incubated with lipofectin encapsulated anti-sense oligonucleotides (50 nM final concentration for each oligonucleotide) in serum- and antibiotic-free DMEM/F12 at 37° C in 95%/5% air/CO2 for 18 hr. Cells were then changed to supplemented medium and incubation continued for 30 hr. This cycle was repeated two additional times. As controls for specificity, replicate cultures were treated with 100 nM oligonucleotide complementary to AS 2, lipofectin only or medium changes only. After oligonucleotide treatment, alkylator sensitivity was assayed by clonogenic survival assays.

• We are setting up the techniques and producing the preliminary data for producing and analyzing new hormonal/growth factor based therapies.
  
  
• We are continuing our efforts to evaluate and improve therapies for brain stem gliomas. New therapeutic drugs are being developed and used to destroy the vasculature in the tumor to effectively starve the tumor.
  
  
• Therapies are being developed and improved, using both radiation, radio-surgery/gamma knife, and chemo-therapeutic drugs to de-bulk and shrink the tumor to relieve pressure on the spinal cord

Research Methods:

Our laboratory utilizes a wide variety of cell and molecular biology approaches to study Tumor resistance and response to therapeutic agents:

• Procurement of tissue in OR for:
  
  • Cell line establishment
    
  • DNA and RNA extractions
    
  • Immunohistochemistry
  
  
• Pediatric brain tumor cell line:
  
  • Establishment
    
  • Characterization
    
  • Maintenance
  
  
• Tissue analysis
  
  • Immunohistochemistry
    
    • DNA repair enzymes
      
    • Growth factors and Receptors
      
    • Matrix mtalloproteinases
    
    
  • DNA repair activities
    
    • O6- methylguanine-DNA methyltransferase
      
    • Apurinic/apyrimidinic Endonuclease
      
    • DNA polymerase Beta
      
    • DNA glycosolases
    
    
  • Statistical analysis of patient clinical Data with DNA repair
  
  
• Cell line analysis
  
  • Direct relationships between repair activity and cellular sensitivity
    
  • Use of sense and anti-sense constructs to specifically alter a repair enzyme/pathway to measure the mechanistic contribution
    
  • Exposure to new experimental Drugs to test resistance and cellular response
    
  • DNA RNA and protein analysis of cell lines exposed to different therapeutic agents
  
  
• Maintenance of pediatric brain tumor bank

Present Lab Members:	Previous Lab Members:
- Mary Gross	- Carson Burrington
- Mark Schleigh	- Asia Cruz
	- David Eraka
	- Bobby Stevens
	- Abel Jarell
	- Justin Bragga

Bibliography:

SELECTED PUBLISHED AND ACCEPTED ARTICLES IN REFEREED JOURNALS:

1. John R. Silber, Michael S. Bobola, A. Blank, Kathryn D. Schoeler, Peter D. Haroldson, Mary B. Huynh and Douglas D. Kolstoe (2002) The Apurinic/apyrimidinic Endonuclease Activity of Ape1/Ref-1 Contributes to Human Glioma Cell Resistance to Alkylating Agents and is Elevated by Oxidative Stress in press.

2. Bobola MS, Blank A, Berger MS, Stevens BA, Silber JR. Apurinic/apyrimidinic endonuclease activity is elevated in human adult gliomas. Clin Cancer Res. 2001 Nov;7(11):3510-8.

3. Bobola, M.S., M.S. Berger, R.G. Ellenbogen, T.S. Roberts,J.R. Geyer, and J.S. Silber (2001) O6- methylguanine-DNA methyltransferase in pediatric brain tumors: Relation to patient and tumor characteristics. : Clin Cancer Res 7; 613-619

4. Tseng, S.-H., Bobola, M.S., Berger, M.S. and Silber, J.R. (1999) Characterization of taxol sensitivity in human glioma and medulloblastoma-derived cell lines. Neuro-Oncology, 1:101-108

5. Silber, J.R., A. Blank, M.S. Bobola, S. Ghatan,, D.D. Kolstoe and M.S. Berger (1999) O6- methylguanine-DNA methyltransferase-deficient phenotype in human gliomas: frequency and time to tumor progression after alkylating agent-based chemotherapy. Clin Cancer Res 5 P 807-14

6. Silber, J.R., A. Blank, M.S. Bobola, S. Ghatan,, D.D. Kolstoe and M.S. Berger. 1998. O6- Methylguanine-DNA Methyltransferase activity in adult Glioma: relation to patient and tumor characteristics. Cancer Research 58. P 1068-73.

7. Silber, J.R., A. Blank, M.S. Bobola, B.A. Mueller, D.D. Kolstoe and M.S. Berger. 1996. O6- Methylguanine-DNA Methyltransferase and alkylation-related carcinogenesis in human brain. The Proceedings of the National Academy of Science 93: 6941-6946.

8. Bobola M.S., S.H. Tseng, A. Blank, M.S. Berger, J.R. Silber. 1996. The role of O6- Methylguanine-DNA Methyltransferase in resistance of human brain tumor cell lines to the clinically relevant methylating agents temozolomide and streptozotocin. Clinical Cancer Research 2: 735-742.

9. Bobola M.S., M.S. Berger, J.R. Silber. 1995. Contribution of O6- Methylguanine-DNA Methyltransferase to Monofunctional Alkylating-Agent Resistance in Human Brain Tumor-Derived Cell Lines. Molecular Carcinogenisis 13:70-80.

10. Bobola M.S., M.S. Berger, J.R. Silber. 1995. Contribution of O6- Methylguanine-DNA Methyltransferase to Resistance to 1,3-(2-Chloroethyl)-1-Nitrosourea in Human Brain Tumor-Derived Cell Lines. Molecular Carcinogenisis 13:81-88.

11. Keles G.E., M.S. Berger, J. Srinivasan, D.D. Kolstoe, M.S. Bobola, J.R. Silber 1995. Establishment and Characterization of Four Human Medulloblastma Derived Cell Lines. Oncology Research 7: 493-504.

12. Silber J.R., M.S. Bobola, T.G. Ewers, M. Muramoto, and M.S. Berger. 1992. O6-alkylguanine DNA-alkyltransferase is not a major determinant of sensitivity to 1,3-bis (2-chloroethyl)-1-nitrosourea in four medulloblastoma cell lines. Oncology Research 6:241-248.